SNP View for TcSNP|snp|4028218

Summary information for this SNP

Containing assembly (Assembly ID): aln.430809
Alignment depth (number of contained sequences): 3
SNP Score (Probablility): 0.74
SNP Type: non_synonymous
SNP Codon Position (1-3): 2
SNP Assembly Position: 224
SNP Reference Genome Contig Location:
Contig: AAHK01001267 (RefSeq NW_919987); Location: 6000
Contig: AAHK01008758 (RefSeq NW_912495); Location: 511
Major allele: C (frequency: 0.67)

Number of alleles: 2
[Allele 1]
  Character: C
  Present in: 2 sequences
  Present in these strains: Tulahuen CL Brener
  Present in codon CCC: coding for aminoacid Pro
[Allele 2]
  Character: T
  Present in: 1 sequence
  Present in this strain: CL Brener
  Present in codon CTC: coding for aminoacid Leu


Sequence Context:

                    C
GGGTGTGGGTGGCCAACTCC CCGGCAATGCCCGGCTGCTT
                    T

Note: only one SNP is shown in this representation. Other polymorphic sites in the flanking sequence (if any) are not shown. You can also view this SNP in context with other SNPs in a small slice of the original alignment, centered around this SNP.