SNP View for TcSNP|snp|4028216

Summary information for this SNP

Containing assembly (Assembly ID): aln.430809
Alignment depth (number of contained sequences): 3
SNP Score (Probablility): 0.22
SNP Type: synonymous
SNP Codon Position (1-3): 3
SNP Assembly Position: 219
SNP Reference Genome Contig Location:
Contig: AAHK01008758 (RefSeq NW_912495); Location: 516
Contig: AAHK01001267 (RefSeq NW_919987); Location: 5995
Major allele: A (frequency: 0.67)

Number of alleles: 2
[Allele 1]
  Character: A
  Present in: 2 sequences
  Present in this strain: CL Brener
  Present in codon CAA: coding for aminoacid Gln
[Allele 2]
  Character: G
  Present in: 1 sequence
  Present in this strain: Tulahuen
  Present in codon CAG: coding for aminoacid Gln


Sequence Context:

                    A
ATGCACGTCCTGTGGATTCA GTCCGAAACGAAAGCGAGTC
                    G

Note: only one SNP is shown in this representation. Other polymorphic sites in the flanking sequence (if any) are not shown. You can also view this SNP in context with other SNPs in a small slice of the original alignment, centered around this SNP.