SNP View for TcSNP|snp|4028208

Summary information for this SNP

Containing assembly (Assembly ID): aln.430809
Alignment depth (number of contained sequences): 3
SNP Score (Probablility): 0.74
SNP Type: synonymous
SNP Codon Position (1-3): 3
SNP Assembly Position: 141
SNP Reference Genome Contig Location:
Contig: AAHK01001267 (RefSeq NW_919987); Location: 5917
Contig: AAHK01008758 (RefSeq NW_912495); Location: 594
Major allele: C (frequency: 0.67)

Number of alleles: 2
[Allele 1]
  Character: C
  Present in: 2 sequences
  Present in these strains: Tulahuen CL Brener
  Present in codon GGC: coding for aminoacid Gly
[Allele 2]
  Character: A
  Present in: 1 sequence
  Present in this strain: CL Brener
  Present in codon GGA: coding for aminoacid Gly


Sequence Context:

                    A
CTGTGTTTCGAGCTTTGTGG GTGCGTGCATTGTGGCATCA
                    C

Note: only one SNP is shown in this representation. Other polymorphic sites in the flanking sequence (if any) are not shown. You can also view this SNP in context with other SNPs in a small slice of the original alignment, centered around this SNP.