SNP View for TcSNP|snp|4028201

Summary information for this SNP

Containing assembly (Assembly ID): aln.430809
Alignment depth (number of contained sequences): 3
SNP Score (Probablility): 0.74
SNP Type: non_synonymous
SNP Codon Position (1-3): 2
SNP Assembly Position: 41
SNP Reference Genome Contig Location:
Contig: AAHK01001267 (RefSeq NW_919987); Location: 5817
Contig: AAHK01008758 (RefSeq NW_912495); Location: 694
Major allele: T (frequency: 0.67)

Number of alleles: 2
[Allele 1]
  Character: C
  Present in: 1 sequence
  Present in this strain: CL Brener
  Present in codon TCC: coding for aminoacid Ser
[Allele 2]
  Character: T
  Present in: 2 sequences
  Present in these strains: Tulahuen CL Brener
  Present in codon TTC: coding for aminoacid Phe


Sequence Context:

                    C
TTGGGCACACGGTGCGCTGT CCTCGCCGGCATTCTCCTGC
                    T

Note: only one SNP is shown in this representation. Other polymorphic sites in the flanking sequence (if any) are not shown. You can also view this SNP in context with other SNPs in a small slice of the original alignment, centered around this SNP.