TcSNP alignment 438249

Summary information:

Number of Contained Sequences: 2 | Consensus Length: 3672 bp | Assembly Consistency: 100
Assembly notes:

SNPs found: 117
Synonymous: 47   |   Non-synonymous:: 57   |   Nonsense: 1

Sequences in this alignment:
XM_814229   CL Brener   Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.10470535 ...
XM_808591   CL Brener   Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.10470535 ...

Reference sequences:
Tc00.1047053511907.190  –  Find this gene also at TriTrypDB | GeneDB | TDR Targets | OrthoMCL  –  Search TcSNP for divergent copies of this gene.
Tc00.1047053506801.70  –  Find this gene also at TriTrypDB | GeneDB | TDR Targets | OrthoMCL  –  Search TcSNP for divergent copies of this gene.

Additional information (BLAST).

 

 

Alignment display controls

Only paint SNPs that have a score greater than:   [ Valid range: 0-1 ]
Display alignment from base:    to  [ Valid range: 1-3672 ]

 

 

Alignment

Alignment legend: polymorphic sites in the alignment have been decorated using different colors and/or font styles to show different properties of each site.

Property Score Synonymous Nonsynonymous Nonsense Not analyzed
Style used Background color Black White Bold, Underline Italics
Example: 0 score color key 1   A       G     A       G     A       G     A     G  

  NOTE: reference CDSs are shown in UPPERCASE

                    1|__________________________________________________________|60
XM_808591            ATGTGGCCATATCCGTTGGCTGTGAGAATGGGATGGAGGAGGATGAGGTTGTGGATCTCT    CL Brener

                   61|__________________________________________________________|120
XM_808591            CCTTCTTGTCCATGGTGGGTGGCTGCTGGCAGTGTGTGTGTGTGTGTGTGTGTGTGTTGT    CL Brener

                  121|__________________________________________________________|180
XM_808591            GGGGACCGTTTTGCGTTGTGTGCACGCGGTGGGTTGTCGCCTTTGATTTTCTTTTTGTTC    CL Brener

                  181|__________________________________________________________|240
XM_808591            TCTCGATTTGCCGCACTCAATTCTTTTGTTTTTTTTGTTTTTGTTTTTGTTTTTTTGAGT    CL Brener

                  241|__________________________________________________________|300
XM_814229            ---------------------ATGCGTGACGGCACTGTTGGGGCTGCTCATGAAATATGG    CL Brener
XM_808591            GGTGAGGAAGTTGGTGGACGCATGCGTGACAGCACTGTTGGGGCTGCTCATGAAATATGG    CL Brener

                  301|__________________________________________________________|360
XM_814229            ACGAGTACAGTTGACATGCTGGTGTCAGAGAGGAGCAGTCTGCAGCTGATTGTGGACACA    CL Brener
XM_808591            ACAAGTACAGTTGACATGCTGGCGGAAGAGAGGAGCAGTCTGCAGCTGATTGTGGACACA    CL Brener

                  361|__________________________________________________________|420
XM_814229            CTGCATGCCACACTCGACTACCACCAAGTTGGAAGGGGTCCCGCGAACTACAACAACAAC    CL Brener
XM_808591            CTGCATGCCACACTCGACTATCACCAAGTTGGAAGGGGTCTTGCGAACAACAACAACAAC    CL Brener

                  421|__________________________________________________________|480
XM_814229            GACA------GTCACAGTTTACTCCGTAATGGTGATGGAAATGTGTTTGCCTCTGAGGAG    CL Brener
XM_808591            GACAACGACAGTCACAGTTTACTCCGTAGTGGTGATGGAAATGTGTTTGCCTCAGAGGAG    CL Brener

                  481|__________________________________________________________|540
XM_814229            GAAGTGGTCGAACTGCTCGGCATGCTGCCTCAAGTTCTTCGTAGTGCTGCCGACCCGGCC    CL Brener
XM_808591            GAAGTGGTCGAACTGCTCGGCATGCTGCCTCAAATTCTTCGTAGGGCTGCCGACCCAGCC    CL Brener

                  541|__________________________________________________________|600
XM_814229            ATTCTGCAGCTGAAGGAGCGGCAACGGCAGTCCATGACTATTGCTGGCGTTGCACGTCCA    CL Brener
XM_808591            ATTCTGCAGCTGAAGGAGCGGCAACGACAGTCCATGACTATTGCTGGCGTTGCACGTCCA    CL Brener

                  601|__________________________________________________________|660
XM_814229            CCTCCGTTGTCGCGTCACGCCACATTATATCGTCTTATGTTTGCTCAGGCCGAATCGTCC    CL Brener
XM_808591            CCTCCGTTGTCGCGTCACACCACATTATATCGTCTTATGTTTGCTCAGGCCGAATCGTCC    CL Brener

                  661|__________________________________________________________|720
XM_814229            TTATCTTCGTCCATTGGCTCTGGGGAGTGTGGTGTGCTAGACTGCATTGCACGTGTGCTC    CL Brener
XM_808591            TTATCGTCGTCCATTTGCCCTGGGGAGTGTGGTGTGCTAGACTGCATTGCACGTGTGCTC    CL Brener

                  721|__________________________________________________________|780
XM_814229            ATAAGCGGAGTTGGTACAAGCGGCATGAGTTCATCCGGGATGCTTTCAGGAAAGCCTCGC    CL Brener
XM_808591            ATAGGCGGAGTTGGTACAAGCGGCATGAGTTCATCCGGGATGCTTTCAGGGGAGCCTCGC    CL Brener

                  781|__________________________________________________________|840
XM_814229            CAGGTGTTTGTTACTGCTAATAGAGAAAAGTCGTGGTTTACAGGAAATGTCACAATTGCA    CL Brener
XM_808591            CAGGTGTTTGTTACTGCTAATAGAGAAAAGACGTGGTTTACAGGAAATGTCACAGTTGCT    CL Brener

                  841|__________________________________________________________|900
XM_814229            GCGCTTCGTTCGCTTGGTGAGATTGTTGAATTGTGTCTTCACGACACTGGAGAAGAGACA    CL Brener
XM_808591            GCGCTTCGTTCGCTTGGCGAGATTGTTGAATTGTGTCTTCACGACACTGGAGAAGAGACA    CL Brener

                  901|__________________________________________________________|960
XM_814229            CACGTTGGCGGAAGCATTTCCAGTGCATACTCTGGTCGCCGTATGACGTTGTTGGGCGGC    CL Brener
XM_808591            CGCGTTGGCGGAAGCATTTCCAGTGCACACTCTGGTCGCTGCATGACGTTGCTGGACGGC    CL Brener

                  961|__________________________________________________________|1020
XM_814229            GAAGATACGGTAGAGAAGTACAAATTGCTGCTAGACGCACTCGGGAAATCATTGTGCCAA    CL Brener
XM_808591            GAAGATACGGTAGAGACGTACAAATTGCTGCTAGACGCACTCGGTCAATCATTGTGCCAA    CL Brener

                 1021|__________________________________________________________|1080
XM_814229            ACCGGCCTTTTTGACCATCTCTGGCACGCCCTTTTGTTTCACCCCGTCATGAATACGCAG    CL Brener
XM_808591            ACCGGCCTTTTTGACCATCTCTGGCACGCCCTGTTGTTTCATCCCGTCATGAATACGCAG    CL Brener

                 1081|__________________________________________________________|1140
XM_814229            CGTATAGCGATTGTGCGGGTACTTTGCGACGTAAGCCGCGTTGATCTTTTGCGGCTTCCA    CL Brener
XM_808591            CGTATAGCGATTGTGCGGGTACTTTGCGACGTGAGCCGCGTTGATCTTTTGCGGCTTCCA    CL Brener

                 1141|__________________________________________________________|1200
XM_814229            GTTGTTATTAAAAGAACGCGGCATATGATGACCCCTGCTGTGTGGGGTGAGCGGGTCTCA    CL Brener
XM_808591            GTTGTTATTAAAAGAACGCGGCATATGATGACCCCTGCTGTGTGGGGTGAGCGGGTCTCA    CL Brener

                 1201|__________________________________________________________|1260
XM_814229            GAATGTATTCTCTCCGATCCCACCGCAATGGTGAAGGAATCTATTGCCGTAATGCTCTAT    CL Brener
XM_808591            GAATGTATTCTCTCCGATCCCACTGCAATGGTGAAGGAATCTATTGCCGTAATGCTCTAT    CL Brener

                 1261|__________________________________________________________|1320
XM_814229            GAAGGACTACAGTCCGTGCTGGGGGCTGACCGTCGCGGTGACGACTATGATGATCATGTC    CL Brener
XM_808591            GAAGGACTACAGTCCGTGCTGGGGGCTGACCGTCGCGGTGACGACGACGTTGATCATGTC    CL Brener

                 1321|__________________________________________________________|1380
XM_814229            TACTGGAGGCGTTGGCTGACAAACCGCTCGTTACGATTTCTCCTGGGTGTTTTGGCAACA    CL Brener
XM_808591            TACTGGAGACGGTGGCTGACAAACCGCTCGTTACGATTTCTGCTGGGTGTTTTGGCAACA    CL Brener

                 1381|__________________________________________________________|1440
XM_814229            GGGGCCTCTCTTGCGGTGCTGCAGCCAGTGCTGGGTTCCTTGTTTTTAGTTCTGGAACAA    CL Brener
XM_808591            GGGGCCTCTCTTGCGGTGCTGCAGCCAGTGCTGGGTTCCTTGTTTTTGGTTCTGGAACAA    CL Brener

                 1441|__________________________________________________________|1500
XM_814229            GACCTGTGGGAGGGTGCAACACGACAGTTTCGATCAGGAAGATCTGTGGCGGAGCGTATT    CL Brener
XM_808591            GACCTGTGGGAGGGTGCAACACGACAGCGTCGATCAGGAAGATCTGTGACGGAGCGTATT    CL Brener

                 1501|__________________________________________________________|1560
XM_814229            GACGTAACATCAATTGTGGAGGTGTGTGCCACGGTACTGGTGCATCTTTTTACCGGTCCA    CL Brener
XM_808591            GACGTAACATTAATTGTGGAGGTGTGTGCCACGGTCATGGTGCATCTTTTTACCGGTCCA    CL Brener

                 1561|__________________________________________________________|1620
XM_814229            GCCGCCGTGAACGGACGAAGGTTTGACGATGATGGGGATAAGCAGTTGAAAAGGTATCGT    CL Brener
XM_808591            GCCGCCGTGAACGGACGAAGGTTTGACGATGATGGGGATGAGCAGTTGAAAAGATATCGT    CL Brener

                 1621|__________________________________________________________|1680
XM_814229            TTTCTCGTTCGAGGTGCGGTGCGGTTGCTCCGCCTCGCGTTGAAAAGAGTTGATCAACTG    CL Brener
XM_808591            CTTCTCGTTCGAGGTGCGGTGCGGTTGCTCCGCCTCGCGTTGAAAAGAGTTGATCAACTG    CL Brener

                 1681|__________________________________________________________|1740
XM_814229            TTGGGCAGCCCAAACATAGTTCAGCAGCCGAAGGGCGGCGGTGATGCTGAGAAAGAGGCT    CL Brener
XM_808591            CTGGGCAGCCCAAACATAGTTCAGCAGCCGAAGGGCGGCGGTGATGCCGAGAAAGAGGCT    CL Brener

                 1741|__________________________________________________________|1800
XM_814229            TGTGCGCTTTTGAGTGCGTGCGTGGAGAAACAAGTGCTGGCCGCCGTAATGAAGTGCTTG    CL Brener
XM_808591            TGTGCGCTGTTGAGTGCGTGCGTGGAGAAACAAGTGATGGCCGCCGTAATGAAGTGCTTG    CL Brener

                 1801|__________________________________________________________|1860
XM_814229            GAGATGTCGCCGGATGGGTCCAGCATGTGTTCCTTCGTGACAAGGTCGATGCGGGCGGAG    CL Brener
XM_808591            GAGATGTCGCCGGATGGATCCAGCATGTGTTCCTTCGTGACAAGGTCGATGCGGGCGGAG    CL Brener

                 1861|__________________________________________________________|1920
XM_814229            ATGGTGCGGTTCGTACGTGACCTGCTCGAGCGAGCCTCCCCGCCACTGTTCTTCTTGACG    CL Brener
XM_808591            ATGGTGCGGTTCGTACGTGACCTGCTCGAGCGAGCCTCCCCGCCACTGTTCTTCTTGACG    CL Brener

                 1921|__________________________________________________________|1980
XM_814229            TGCAAGCTGGTGCCTTACTTGCCAACGATGCTGCAGATAATTTTAGATGCAAGAGAGGAG    CL Brener
XM_808591            TGCAAGCTGGTGCCTTACTTGCCAACGATGCTGCAGATAATTTTAGATGCAAGAGAGGAG    CL Brener

                 1981|__________________________________________________________|2040
XM_814229            GGCGTCTTGGATGACCGTGACTGTTGCAACGCCGATGGCGGCAGCGATGCGCTTCCCTCT    CL Brener
XM_808591            GACATCTTGGATGACCGTGACTGTTGCAACGCCGATGGCGGCAGCGATGCGCTTCCTTCT    CL Brener

                 2041|__________________________________________________________|2100
XM_814229            TCCCAGCTGTACGTGGAGGCGTTGTGTAGTGATGGGGTAGAAATGATCTCTCTTCTCGGC    CL Brener
XM_808591            TCCCAGCTGTACGTGGAGGCGTTGTGTAGTGATGGGGTCGAAATGATCTCTCTTCTCGGC    CL Brener

                 2101|__________________________________________________________|2160
XM_814229            ATGATGTTGTGGTTCTCGCCGTCAGTGCGGGACCGCTTTCTGGACGTGCTTGCCTCCCTG    CL Brener
XM_808591            ATGATGTTGTGGTACTCGCCGTCAGTGCGGGACCGCTTTCTGGACGTGCTTGCCTCCCTG    CL Brener

                 2161|__________________________________________________________|2220
XM_814229            CAGTTTACACCGGAACAACAGGGTGTCTTCTTCGACTCCATGGAATCAATTGCCCGTTCT    CL Brener
XM_808591            CAGTTTACACCGGAACAACAGGGTGTCTTCTTCGACTCCATGGAATCACTTGCCCGTTCT    CL Brener

                 2221|__________________________________________________________|2280
XM_814229            TTGCCGTCACATGCCGTGAGGAATCTCCTTATTGTGGACGCGACTGGCACTTTGTTGAAT    CL Brener
XM_808591            TTGCCATCGCATGCCGTAAGGGATCTCCTTATTGTGGACGCGACTGGTACTGTGTTGAAT    CL Brener

                 2281|__________________________________________________________|2340
XM_814229            GAAGTGGGTCGGCTGCCGTGGCAAGGAGAGCAGCTGCAGACGGAATCACTGGAGCGGTTG    CL Brener
XM_808591            GAAGTGGGTCGGCTGCCGTGGCAAGGAGAGCAGCTGCAGACGGAATCACTGGAGCGGTTG    CL Brener

                 2341|__________________________________________________________|2400
XM_814229            CTCCTACTGCAGCTGCATCGTCAGCGGGAATTGGTGAACCGAGAGAAAGTGGCAGACCGT    CL Brener
XM_808591            CTCTTACTGCAGCTGCATCGTCAGCGGGAATTGGTGAACCGAGAGAGAGTGGCAGACCGT    CL Brener

                 2401|__________________________________________________________|2460
XM_814229            TTTACTCCTGAAGGTCGGTGGATGTCCGTGCAGCAGCAGCGGTGGAAACTGGGACCGCAG    CL Brener
XM_808591            TTTACTCCTGAAGGTCGGTGGGCATCTGTGCAGCAGCAGCGGTGGAAACTGGGACCGCAG    CL Brener

                 2461|__________________________________________________________|2520
XM_814229            CACGGCTATGCGAGCCGCGTGCTTGTGTGCTTCGTCCTGCACCATCTTCGCAATGGTTCC    CL Brener
XM_808591            CACGGCCATGCGAGCCGCGTGCTTGTGTGCTTCGTCCTGCATCATCTTCGCAATGGTTCC    CL Brener

                 2521|__________________________________________________________|2580
XM_814229            GGGAAGCGGGAAGTGGGTGACGACCACGAC------GACGAAGACGAAGAAGGGGAGGCC    CL Brener
XM_808591            GGGAAGCGGGAATTGGGTGACGACCACGACCACGACGACGAAGACGAAGAAGGGGAGGCT    CL Brener

                 2581|__________________________________________________________|2640
XM_814229            GGTGGTGTGTCTGTCTCGCCAATTCAACCGAGCACCTGCAAAAGCACTGTGGGGCAACGT    CL Brener
XM_808591            GGTGGTGTGTCTGTTTCGCCAATTCAACCGAGCACCAGCAAAAGCACTGTGGGGCAACGT    CL Brener

                 2641|__________________________________________________________|2700
XM_814229            GTGGGTGGCATCATTGGTGAACCGCAGACGATTCCCCGTTGCGGTGATGAAATCATCCTT    CL Brener
XM_808591            GTGGGCGGCATCATTGGCGAACCGCAGACTATTCCCCGTTGCGGTGATGAACCCATCCTT    CL Brener

                 2701|__________________________________________________________|2760
XM_814229            CTCAGGCCGCGCTGCACTCTGCCGTTGGGCCGTCAGGCGTCGCGACGTGGAGAGGAAGCG    CL Brener
XM_808591            CTCAGGCCGCGCCGCACTCTGCCGTTGGGCCGTCAGGCGTCGCGAAGTGGAGAGGAAGCG    CL Brener

                 2761|__________________________________________________________|2820
XM_814229            GAGGAAGAAGACGTCGAGGAGGGAAGCGGATGCCACGAAAGTGCCAGCGACAAGTTGTGG    CL Brener
XM_808591            GAGGAAGAAGACGTCGAGGAGGGAAGTGGATGCCACGAAAGTGCCAGCGACAAGTTGTGG    CL Brener

                 2821|__________________________________________________________|2880
XM_814229            CTGCAACGTGAGCTGGGCAGCCATTCGCCAGACGCTTCACGACCAAAACTACAGCAAACG    CL Brener
XM_808591            CTGCAACGTGTGCTGGGCAGCCATTCGCCAGACGCTTCTCGACCAAAAGTACAGCAAACG    CL Brener

                 2881|__________________________________________________________|2940
XM_814229            ATGGCAGTGCCGACGCGCATTTCAGCTTCGGTGGCAAGTAGAAACGCAATAGATCCATTA    CL Brener
XM_808591            ATGGCAGCGCCGACGCGCATGTCAGCCTCGGTGGCAAGTAGAAACGCAATGGAGCCATTA    CL Brener

                 2941|__________________________________________________________|3000
XM_814229            GAACGCGTGCGACAGCGGCAACTAGAGAGTATTGCCACGGAGGAAAAGGCGTACCGGGTG    CL Brener
XM_808591            GAACGCGTGCGACAGCGGCAACTAGAATGTATTGCCGCGGAGGAAAAGGCGTACCGGGTG    CL Brener

                 3001|__________________________________________________________|3060
XM_814229            GCCCTGGGGTTGTTTGCATCCCTTGCGTCGCGATACTACCGGCACCTCTTAACACCTCAG    CL Brener
XM_808591            GCCCTGGGGTTGTTTGCATCCCTTGCGTCGCGGTAA------------------------    CL Brener

                 3061|__________________________________________________________|3120
XM_814229            GCAGCCTTGGAGTACTTGCATCGCCAGGAGCACGGGGCACCCCAGCGGAGACACGTAAAC    CL Brener

                 3121|__________________________________________________________|3180
XM_814229            CCTGTCCCGCCCACACCGCCGTCCGCGAGAACAGGCGTAAACAACAGCAGCACCACATTG    CL Brener

                 3181|__________________________________________________________|3240
XM_814229            CGTCTATGGACGGCCCGCGATGTGTGTCGGGAGGACCTCTTCTACTTCTCCCTTCCTCTT    CL Brener

                 3241|__________________________________________________________|3300
XM_814229            AGTGCAATATGTGAGGCAGCCATAGCCGATCTCGTGGAGCGGTGCAAGAGACACCGGCAG    CL Brener

                 3301|__________________________________________________________|3360
XM_814229            GCGCTGCAAAGAAAATTACGAACCCTACCGCATTCATCGCGTGGACGTCGTTGGTTCTTG    CL Brener

                 3361|__________________________________________________________|3420
XM_814229            CAGGACGCGGCGACAAATATCATGGGCCGCCTCATTGCGCTCTTTCAGATTCTCCTGCAT    CL Brener

                 3421|__________________________________________________________|3480
XM_814229            CACATCCAGCGCGAAGGAGAGAAAGCAGTGCGGGAGGCAATTGCGCAGATGCCGATTTTG    CL Brener

                 3481|__________________________________________________________|3540
XM_814229            CCTGAAGTTGAGGATGAGGATTTCGTAAACGATTTGGCTGAGCGATATAATTGCAGGTAT    CL Brener

                 3541|__________________________________________________________|3600
XM_814229            CTCACACTGCGGGAATTGCATGGTGGCACGCTTGTCGAGGTTACGAAGTTCATTGTTCGA    CL Brener

                 3601|__________________________________________________________|3660
XM_814229            TGTTTTTCACGTCCTGCGGATCCGGGTGGGGAAGACGCAACGGACTCTTCTTTCCGGCCG    CL Brener

                 3661|__________|3672
XM_814229            CGTATGGACTGA                                                    CL Brener

[+/–] Show/Hide decorated alignment