TcSNP alignment 430809  Showing SNP ID 4028191

Summary information:

Number of Contained Sequences: 3 | Consensus Length: 575 bp | Assembly Consistency: 97
Assembly notes:

SNPs found: 42
Synonymous: 11   |   Non-synonymous:: 30   |   Nonsense: 0

Sequences in this alignment:
XM_802986   CL Brener   Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.10470535 ...
XM_797109   CL Brener   Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.10470535 ...
32150962   Tulahuen   TcAmaPl04Run01_G08 Trypanosoma cruzi amastigote cDNA library Trypanoso ...

Reference sequences:
Tc00.1047053508833.10  –  Find this gene also at TriTrypDB | GeneDB | TDR Targets | OrthoMCL  –  Search TcSNP for divergent copies of this gene.
Tc00.1047053510437.45  –  Find this gene also at TriTrypDB | GeneDB | TDR Targets | OrthoMCL  –  Search TcSNP for divergent copies of this gene.

Additional information (BLAST).



Alignment display controls

Only paint SNPs that have a score greater than:   [ Valid range: 0-1 ]
Display alignment from base:    to  [ Valid range: 1-575 ]


Move Window 39 bases to right

View full alignment


Alignment : showing 39-bases window (from 1 to 39)

Alignment legend: polymorphic sites in the alignment have been decorated using different colors and/or font styles to show different properties of each site.

Property Score Synonymous Nonsynonymous Nonsense Not analyzed
Style used Background color Black White Bold, Underline Italics
Example: 0 score color key 1   A       G     A       G     A       G     A     G  

  NOTE: reference CDSs are shown in UPPERCASE

XM_802986            ATGGAAGTGTGCGTGCTGCCTTGGGCACACGGTGCGCCG                         CL Brener
32150962             -------cggcacgagcaccttgggcacacggtgcgctg                         Tulahuen
XM_797109            ATGGAAGTGTGCGTGCCACCTTGGGCACACGGTGCGCTG                         CL Brener

[+/–] Show/Hide decorated alignment